Medium· Transposons· +4 / −1
Transposons can be used during which one of the following?
Molecular Basis of Inheritance: NEET 2022
Related questions
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end:
NEET 2024 · Easy
The lactose present in the growth medium of bacteria is transported to the cell by the action of
NEET 2024 · Easy
Match List-I with List-II. List-I: (A) Frederick Griffith, (B) Francois Jacob & Jacque Monod, (C) Har Gobind Khorana, (D) Meselson & Stahl…
NEET 2024 · Easy
Which of the following statement is correct regarding the process of replication in *E. coli*?
NEET 2024 · Medium
Which one is the correct product of DNA dependent RNA polymerase to the given template? 3' TACATGGCAAATATCCATTCA 5'
NEET 2024 · Easy
Match List I with List II: List-I: A. RNA polymerase III, B. Termination of transcription, C. Splicing of Exons, D. TATA box List-II: I.…
NEET 2024 · Medium