Which one is the correct product of DNA dependent RNA polymerase to the given template? 3' TACATGGCAAATATCCATTCA 5'
NEET 2024 · Easy
In the *lac* operon, the *z* gene codes for
NEET 2026 · Easy
Which of the following statements are correct with reference to a transcription unit? A. A transcription unit in DNA is defined primarily…
NEET 2026 · Easy
Arrange the following steps of DNA fingerprinting in a correct sequence. A. Isolation of DNA and its digestion by restriction…
NEET 2026 · Medium
Which of the following statements are correct with reference to packaging of DNA helix? A. Histones are organized to form a unit of eight…
NEET 2026 · Medium
Which of the following statements about lac-operon is correct?
RE-NEET 2026 · Medium
