Easy· Transcription (Process of Transcription)· +4 / −1
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3' TACATGGCAAATATCCATTCA 5'
Molecular Basis of Inheritance: NEET 2024
Related questions
Match List I with List II: List-I: A. RNA polymerase III, B. Termination of transcription, C. Splicing of Exons, D. TATA box List-II: I.…
NEET 2024 · Medium
In the *lac* operon, the *z* gene codes for
NEET 2026 · Easy
Which of the following statements are correct with reference to a transcription unit? A. A transcription unit in DNA is defined primarily…
NEET 2026 · Easy
Arrange the following steps of DNA fingerprinting in a correct sequence. A. Isolation of DNA and its digestion by restriction…
NEET 2026 · Medium
Which of the following statements are correct with reference to packaging of DNA helix? A. Histones are organized to form a unit of eight…
NEET 2026 · Medium
Which of the following statements about lac-operon is correct?
RE-NEET 2026 · Medium