Easy· Regulation of Gene Expression (Lac-Operon)· +4 / −1
The lactose present in the growth medium of bacteria is transported to the cell by the action of
Molecular Basis of Inheritance: NEET 2024
Related questions
In the *lac* operon, the *z* gene codes for
NEET 2026 · Easy
Which of the following statements about lac-operon is correct?
RE-NEET 2026 · Medium
Match **List I** with **List II**. | List I | List II | |---|---| | A. Gene 'a' | I. β -galactosidase | | B. Gene 'y' | II. Transacetylase…
NEET 2023 · Easy
Match List-I with List-II. List-I: (A) Frederick Griffith, (B) Francois Jacob & Jacque Monod, (C) Har Gobind Khorana, (D) Meselson & Stahl…
NEET 2024 · Easy
Which of the following statement is correct regarding the process of replication in *E. coli*?
NEET 2024 · Medium
Which one is the correct product of DNA dependent RNA polymerase to the given template? 3' TACATGGCAAATATCCATTCA 5'
NEET 2024 · Easy