Easy· Transcription (Transcription Unit)· +4 / −1
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end:
Molecular Basis of Inheritance: NEET 2024
Related questions
Which of the following statements are correct with reference to a transcription unit? A. A transcription unit in DNA is defined primarily…
NEET 2026 · Easy
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5'…
NEET 2023 · Medium
The lactose present in the growth medium of bacteria is transported to the cell by the action of
NEET 2024 · Easy
Match List-I with List-II. List-I: (A) Frederick Griffith, (B) Francois Jacob & Jacque Monod, (C) Har Gobind Khorana, (D) Meselson & Stahl…
NEET 2024 · Easy
Which of the following statement is correct regarding the process of replication in *E. coli*?
NEET 2024 · Medium
Which one is the correct product of DNA dependent RNA polymerase to the given template? 3' TACATGGCAAATATCCATTCA 5'
NEET 2024 · Easy