Medium· Transcription (Transcription Unit)· +4 / −1
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows
5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3' ?
Molecular Basis of Inheritance: NEET 2023
Related questions
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end:
NEET 2024 · Easy
Which of the following statements are correct with reference to a transcription unit? A. A transcription unit in DNA is defined primarily…
NEET 2026 · Easy
Name the enzyme that facilitates opening of DNA helix during transcription.
NEET 2020 · Easy
The first phase of translation is :
NEET 2020 · Easy
If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical…
NEET 2020 · Easy
Which of the following statements is correct?
NEET 2020 · Easy